#dnaday — Public Fediverse posts

Our second #DNADay post of the day is "Where we are in the T2T Genomes Era, Pt 1".

An expert Q&A covering benchmarking and featuring insight from Heng Li, Guojie Zhang and Jue Ruan
http://gigasciencejournal.com/blog/dna-day-2025-t2t-genomes-pt-1/

Nicely timed for #DNAday we have the first benchmarking data for the new CycloneSEQ platform:

Efficiently Constructing Complete Genomes with CycloneSEQ to Fill Gaps in Bacterial Draft Assemblies. GigaByte. 2025. https://doi.org/10.46471/gigabyte.154

More in GigaBlog
http://gigasciencejournal.com/blog/open-cycloneseq-benchmarking-for-complete-bacterial-genomes/

Our first big news of #DNADay 2025🧬 is mission accomplished for #BauhiniaGenome
.

After nearly a decade, our emblematic, crowdfunded community genome project for #HongKong has solved the historical mystery of HK Bauhinia’s origins with a complete gapless T2T genome reference

http://gigasciencejournal.com/blog/mission-accomplished-for-bauhinia-genome/

Read the Research here, which also part of our T2T Series:

The haplotype-resolved T2T genome for Bauhinia × blakeana sheds light on the genetic basis of flower heterosis
https://doi.org/10.1093/gigascience/giaf044

#QuestionOfTheWeek: What are your DNA ethnicity estimates? Any surprises? Share your percentages & discoveries! Compare with relatives to break through brick walls.
https://www.youtube.com/watch?v=nwimjqnLbPw&list=PLEqK4ICkQWXQXODTRG6UGGZ4cmXiMRmD4

#DNADay
#CollaborativeGenealogy #AncestryDNA #23andMe #MyHeritage #FamilyTreeDNA #GEDMatch

#DNAday

catgcgccgccgtatgataacgcggatgcgtat

#DNADay Launch for Hong Kong’s Moonshot for Biology http://gigasciencejournal.com/blog/hong-kong-biodiversity-genomics-consortium/

Pleased to announce the first outputs of the Hong Kong Biodiversity Genomics Consortium are out in a new GigaByte series https://doi.org/10.46471/GIGABYTE_SERIES_0006

The #EJeanCarroll rape case against #DonaldTheDeplorable is underway.

Unfortunately, #Trump will not have his #DNAday 🧬 in front of the judge and jury. 👉 https://vm.tiktok.com/ZTRTc7ema/

@npr ⬆️
How ‘bout “Don’t ask. Don’t tell.” Worked before!

Seriously, nobody cares about #ethnicity and there’s actually no such thing as race.

#Racism is real, but is it manufactured by our obsession with the toxic fantasy of race?

“Chemical Eye 👁️ on the Race Factor” 👉 http://www.sitnews.us/MacDougall/102508_macdougall.html

#biochemistry #DNAday 🧬

As it's #DnaDay considering making "Rosalind Franklin: The Dark Lady of DNA" by Brenda Maddox your next book.

Fascinating biography. Shed light on what really happened in the discovery of the structure of DNA.

Francis Crick comes across as a very unpleasant individual.

#DNADay
What Rosalind Franklin truly contributed to the discovery of DNA’s structure

Franklin was no victim in how the DNA double helix was solved. An overlooked letter and an unpublished news article, both written in 1953, reveal that she was an equal player.
https://www.nature.com/articles/d41586-023-01313-5
h/t @darwinsbulldog

It's #DNADay and the 70th anniversary of the discovery of DNA's double helix structure. Here's a graphic which looks at it in detail 🧬 https://www.compoundchem.com/2015/03/24/dna/

Today, April 25th is #DNADay

If you ask me... it's the perfect date.
https://www.youtube.com/watch?v=-BNwiqDGz5g

A single gram of DNA is capable of holding 700 terabytes of data, which means if you wanted to store all the digital information that exists in the world in DNA format, you'd only need two grams of it.

10 things you might not know about DNA:

https://topicaltens.blogspot.com/2017/04/25th-april-dna-day.html

#DNADay #DNA #Facts #Science

5/5 Solving the mystery of DNA rings: Anton Henssen and scientists from 🇺🇸 and 🇬🇧 research the role that ring-shaped strands of DNA play in the development of #cancer, and how to fight them.

https://www.mdc-berlin.de/news/press/cancer-grand-challenge-henssen

#DNADay #DNADay23

4/5 Antibodies can "steal" pieces of other #genes: Kathrin de la Rosa (@bih_charite) analyzes how the body creates a diverse set of #antibodies to fight off #infections. Her team reports: It's not just mutations @PNASNews

https://www.mdc-berlin.de/news/press/stolen-dna-strengthens-immune-diversity

#DNADay #DNADay23

3/5 Abnormalities in DNA folding presumably cause learning disorders. Ana Pombo and Alexander Kukalev have received a DFG grant to test this hypothesis.
https://www.mdc-berlin.de/news/news/cracking-chromatin-code

#DNADay #DNADay23

2/5 The fins of skates: The key to their #evolution lies in the non-coding bits of the animals’ #genome and the 3D complexes it folds into: TADs. #mdcBerlin scientist @dariloops is among the lead authors of the @nature paper.
https://www.mdc-berlin.de/news/press/how-skates-learned-fly-through-water
#DNADay #DNADay23

70 years ago, Watson and Crick explain a basic principle of life in Nature: #DNA has the structure of a double helix. How the strand of genetic material is packed into the nucleus of a cell is also anything but random.

A 🧵 on our recent research on DNA 👇
#DNADay
📷 Anton Henssen

An interesting read for #DNADay🧬🧬🧬
https://genomebiology.biomedcentral.com/articles/10.1186/gb-2013-14-4-402

🧬 #DNA sequencing technologies on a European level: On May 4, the EASI-Genomics Summit in Berlin will be a grand finale for the project!

Janine Altmüller (#mdcBerlin & @bih_charite) is talking about the past 4 years: https://www.mdc-berlin.de/news/news/grand-finale-european-genome-project

#DNADay #DNADay23

#DNADay
Some genetic testing companies report how much DNA a person has inherited from prehistoric humans, such as Neanderthals and Denisovans.

Here are some guidelines about that:

What does it mean to have Neanderthal or Denisovan DNA?
https://medlineplus.gov/genetics/understanding/dtcgenetictesting/neanderthaldna/

#DNADay
We think of chromosome machinery ensuring unbiased, random segregation.

However...
A more complete understanding of nonrandom segregation may shed light on how speciation occurs.

Probing Centromeres Unveils an Evolutionary Arms Race
https://www.the-scientist.com/features/probing-selfish-centromeres-unveils-an-evolutionary-arms-race-71017

#DNADay
The Allen Ancient DNA Resource (AADR):
A curated compendium of ancient human genomes
https://www.biorxiv.org/content/10.1101/2023.04.06.535797v1

AADR has 6 releases since first available and crossed the threshold of >10,000 ancient individuals with genome-wide data at the end of 2022.

Today. April; 25 is #DNADay
70th anniversary of discovery of the double helix and 20th anniversary of HGP

and Canadians were at the forefront

Canadian science pioneers' role in the Human Genome Project shows why it’s crucial to fund research
https://theconversation.com/amp/canadian-science-pioneers-role-in-the-human-genome-project-shows-why-its-crucial-to-fund-research-204340

#DNAday 70 years ago Watson and Crick have discovered Rosalind Franklin's lab book

(photo credits Merlin Crossley)

CACGCCCCCCCCTATGACAACGCCGACGCCTAT

It's #DNADay! To celebrate the discovery of the double helix structure of DNA exactly 70 years ago, grab some Lego bricks - kids' rooms may be raided - and build a DNA model with us! #LegoDNA