#laddersequencing — Public Fediverse posts
Live and recent posts from across the Fediverse tagged #laddersequencing, aggregated by home.social.
-
@nanopore it doesn't look like much, but I expect that the results from this run are going to produce lots of useful information for me.
I'm sequencing some DNA ladder using an R10.4.1 Flongle flow cell, using an expired Quick ligase enzyme. All going well, I should get some high-accuracy duplex reads that will help me nail down these band sequences.
Yes, I'm doing #LadderSequencing again. Hopefully this time ONT won't release another software update before I finish writing it up.
-
@nanopore it doesn't look like much, but I expect that the results from this run are going to produce lots of useful information for me.
I'm sequencing some DNA ladder using an R10.4.1 Flongle flow cell, using an expired Quick ligase enzyme. All going well, I should get some high-accuracy duplex reads that will help me nail down these band sequences.
Yes, I'm doing #LadderSequencing again. Hopefully this time ONT won't release another software update before I finish writing it up.
-
#P2Solo #LadderSequencing @nanopore I have my first band (100% identity match to lots of different vectors):
>band_100bp
TGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCIt's 137bp, rather than 100bp
-
#P2Solo #LadderSequencing @nanopore I have my first band (100% identity match to lots of different vectors):
>band_100bp
TGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCIt's 137bp, rather than 100bp